Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YM09FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00008784001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12857
Accession: ref|XP_001586279.1| Score: 683 E_value: 3e-70
KEGG Definition: hypothetical protein
Accession: mgr:MGG_11354 Score: 679 E_value: 4e-70
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q06315|SKG3_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005737 = Cellular component: cytoplasm
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD60YM09FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGTTGTGCCGACATACCTCA
ATCTTACCGATGCTTCGATCAAGATGATTGACACTTTGCCGACAAGGTCG
CCGGATGTGCCTCCTCTCACAAACGTTCTCAGTATTTCTACGGCTGGTCG
AAATCGATACCTCTTCCATTTCAACTCACACCACTCCCTGACACAATGGA
CGGCTGGGATCAGGCTATGCATGTTTGAGCACTCCTGCCTACAGGAGGCT
TACACCGGAGCTTTGATCGCGGGGAAGGGCAAGACATTAAATAGTATTAA
TACCATAATGGAGAGGGCCAGATTCAAGTATGAGGATTGGGCCCGGGTTC
GGTTCGGAGCGGGAACCCCTTGGAGGAGGTGTTGGGCTGTTATCACACCG
CCGGACGAGAAATCCGTCAAGAGGCAAAAGGCAATCCTGAAAAAGGCAAA
CAAGTCTGCTTATAATGCTGTTCCGTTTCTCAAAGGCGATATAAAGTTCT
ACGAGAACAAGAAGAGCAAAAAATCACAGCCGATAGCAACCATCACGGAC
GCTTTCTCGGCCTATGCAATC

Sequences in the Contig:

SY0AAD60YM09FM1