Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YK17FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00003278001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: PREDICTED: hypothetical protein
Accession: ref|XP_001196927.1| Score: 363 E_value: 4e-33
KEGG Definition: LOC759240; hypothetical protein LOC759240
Accession: spu:759240 Score: 363 E_value: 2e-33
KOG Definition: No Hit Found
PFAM Definition: YDG_SRA, YDG/SRA domain. The function of this domain is unknown, it contains a conserved motif YDG after which it has been named..
Pfam Number: pfam02182 Score: 319 E_value: 1e-30
Swissprot: Q8VDF2|UHRF1_MOUSE
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0008283 = Biological process: cell proliferation

Sequence:
>SY0AAD60YK17FM1
TTGGCACTCCCGCTTCTATAGGCTACTGACATACTCACCAGCCTACTGTC
GGTGGTATTTACGGCGGTACTACGACTGGAGCGTACTCCGTCGCCGTTTC
TGGCGGATACGAAGACGATGTGGACGAGGGATTTCGCTTCACGTTCACTG
GCTCTGGAGGCCGTGATCTCAAGGGCACCGCGAGTAATCCCAAGAACCTT
CGCACTGCCCCTCAATCCTCTGATCAGACTCTCACCGGCTTCAACCTAGC
ACTAAAGGTTTCCTGCGATACGGGAAACCCGGTCAGGGTTATTCGCGGGT
TTAAAGCCACCCTGGGACCAGAAGAGGGTTACCGTTACGATGGACTCTAC
AAGGTTCTGAAAGCCTGGCAGGAGACTGGCCTGTCCGGATTCAAGGTGTG
GAAATACGCCTTCAAGAGAATCGATGGACAGGCTCCCTTGGATACCAGCA
TTGGAAAACCCGATGACTTTGGTGACGAGGACGACTACAACATCAAGGAC
GAAACCGAGGAAAATCCTGGCCAAGAACCCCCTGAGCCCGGCACCGGAAA
AGCGGAATGGCTTGAGGAAGAAGCAGAAGACCGACCCAAGCGGACTCGCA
GATCCACTCGCAAATCCTACCGAG

Sequences in the Contig:

SY0AAD60YK17FM1