Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YK16FM1
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00001055001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59859.1| Score: 199 E_value: 4e-14
KEGG Definition: predicted protein
Accession: aor:AO090026000403 Score: 199 E_value: 2e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD60YK16FM1
TTGGGGCTTTCCCTGAGGCCAATAGGGAAGGTGGGAAACCTTCCAATGCA
TTGGGCAAAAGGGAAAGGGACGAGGAAGAAGCTGGGAAACTGGAAAAGAA
GAAAAAGCACCACCATCACCATTCGCTGCAGAAACATAGCGCTGTCCATC
ACCATCGTCATCATCATAAGGTTGACGATGAGCCAGCAGGGTCAGGCCTC
GAGATCCCGTTGGCAAGGGCTGGAGCGCGATCCAAGTCACCCAACAGTAT
GGCCATGGCTCATCCGCATCATGTTCATCAAGTGACTGTCCACCATCACC
ATCCTGCTGCTGTTTCACCGGCCCCTCCCCCGCAAAGGGTCAAGACAAGT
CTACTCATAGATTCATCTAAGGTATTGGCTAGCCTGGCTTCGAAACCAAG
GCAGTATCTCGGCTCAACGATATATCAACCCACACCGACCCCCAAACAAG
GATTGTCGGTAACGCAGCCATTGCTGCCGCGATTCGAAGGCAGAGAGAAT
TGCATCTTTCAGGTTCGAATTCCACGTAGGTTCCTCAGTGCGGAGCAGAG
GAGAGATGTGCACAGACGTAGATGTGTGTGGGGTACGGAGGTCTATACGG
ACGATTCCG

Sequences in the Contig:

SY0AAD60YK16FM1