Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YJ18FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00001820001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001542268.1| Score: 538 E_value: 2e-53
KEGG Definition: predicted protein
Accession: aor:AO090005000183 Score: 509 E_value: 2e-50
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0897 Score: 168 E_value: 5e-13
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 120 E_value: 2e-07
Swissprot: Q7YQJ9|UB2Q2_RABIT
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>SY0AAD60YJ18FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTAAAAAGTCTTGTGGGAC
CTTCCACCCATGCGCCCGGCAAGCCCTCACGTACGCATCCCTCGCCTCGC
CCGCCGTATAATCCCTCACAACGCCGGGTACGAGCCTCGCCGGTTTAACC
TCCGACGTAATCGCCATGCGAATCTGCAAGAGTACACTCTCCATACTACT
CGCGGCAGACCATCCTGAATTGGTCAATAACTCCATGCACAGTGCCCCAC
CGGCGGTAACGTGACCACCACCGCCCTCGGCAAAGGCCAGGAACCTGGGT
CGCACGACACGCACGAAGGGTGGTGACATGGGGAAGTTAGGGCCGAATCT
GAATTCTAAGAGAACGGAGGAGAGGTTTTTAGCGGCTAGGTCTGCAGATA
GTGGAATATCTGGGGGGAATGAGTGCAGTTCAATGTGCCATTGGTATACG
TTTGAAACTGAGGATGGGTTCATGTAGAAGCCTAGTTCCTCCAGGGGATA
TTTCTTCTGCAGGGAGAGGAGGTGGTGTAGGTCGGCTGTTAGGCGGCGGG
TCCCGGCGGGGCTTGCATAGGTTGGGGGTGGGAGGAGTAGGACTGATGAG
ATGTTGTGGGTGTCTGGCTGGAAG

Sequences in the Contig:

SY0AAD60YJ18FM1