Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YF05FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00008573001 E-value : 1e-171
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04632
Accession: ref|XP_001795046.1| Score: 427 E_value: 1e-40
KEGG Definition: hypothetical protein
Accession: ang:An01g05510 Score: 408 E_value: 1e-38
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2826 Score: 346 E_value: 1e-33
PFAM Definition: P34-Arc, Arp2/3 complex, 34 kD subunit p34-Arc. Arp2/3 protein complex has been implicated in the control of actin polymerisation in cells. The human complex consists of seven subunits which include the actin related Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc. This family represents the p34-Arc subunit..
Pfam Number: pfam04045 Score: 208 E_value: 1e-17
Swissprot: O14241|ARPC2_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAD60YF05FM1
TTGGCTCTTTTCTACCCCGGCTTTGCACCCTGCCAATTAATTCATCACAG
ATCCTAATCATCAACATGGTACTTGGGATTCCCCACCTGCTGCACCCATG
CTCAGCAATCTTACTAACCGCGAATAAAGCTTCTTCTCGAGTATCACAAC
TTGCTGCTGAAGTCGATCCTAACTGAGCGATTCAATAGTGCAACTGCAGC
CTCAATCGATCAGGTCATCTCCGACTTTGACGGAGTAACATTTCACATTT
CCACTCCGGAGACTAAATCTAAGATACTTGTCTCCATCTCTGTTAAATGC
TATCCAGATCTCCTCCGGCATGGAGCCCAACAAGTCCTTGAACGAGAGTA
TGGACAGCACATCACTGAAACGGAAACTGGATATGACTTCTCCTTGATGG
TTGATTTGGAAAATCTCCCGGCGGAACAAGGTTCCCCCCTCCATCTACTC
TGGTTGATGGCGATAGTTGAAGTAGATGATTACTGACGAATGTGGGGTGA
GCTTGCAGAAGCTAAGGAAGACCTAGTCCGTCGCATATCGCTGTTGAAAC
GTAATACTATGGCAGCACCTTTTGAAAAGGCTATCGATGAGCACCACCGT
CTCGCGGAAGCCTCTAAG

Sequences in the Contig:

SY0AAD60YF05FM1