Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YE01FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00006086001 E-value : 1e-127
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN6608.2
Accession: ref|XP_664212.1| Score: 132 E_value: 3e-06
KEGG Definition: hypothetical protein
Accession: ani:AN6608.2 Score: 132 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD60YE01FM1
TTGGGCGAGATCGAGCGGGAAAGCCAATCCAACCCTTTATCCTGCCTGAA
CGGATGTTCTTTACGAGCTTAGCTATCCCGCTGCCCCCGTAAATATGGTG
AATAGGAATCTGCCAGCCTACAAACCGATCGAAGTTACTTTTCTCAGCGA
GCAAAAGGTGTGTTTGACTCTTTGTGACTTCCAAATCCCGTCCCCATTTG
TGTCCGCGGGTGAGAAGGGGAAATTCGGCTGACGGTATTTTCCATCGCAG
ACGTATGTCTAATGACATTCCATGCCCGACCGATGACCCACTGACAGCTT
TAATCTTTTAGTGACCTGGGAGAAGTGTCGTTCTGGCGCAATAACCTTGT
GATCTTCCCGCTGCCCAGCTCGGGTATCTCCAAGGTTTGGAGGCTAACTA
CCTATTTTAGGTTGCCGCTTCAAAACGCCATAACCATCTATACATTGCCC
TGAGGTCATCAATTCGTGTCTACAGCCCAGCATACCCAAATCAGATCATC
CCGCCAAACCTCTCCTACATAACCCTCACCTCCAGCTTTACCCCAACCGG
ACCCGGGTATATTGACCCCGCAGAACCTCATGCGATCAACTCGCTCACAG
TTGGAGACCTGGGGTTCGAGGAGGTTCTTGTGAGCGCA

Sequences in the Contig:

SY0AAD60YE01FM1