Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YD21FM1
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00010317001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 255 E_value: 2e-20
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 236 E_value: 1e-18
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 185 E_value: 5e-15
PFAM Definition: No Hit Found
Swissprot: O89019|INVS_MOUSE

Sequence:
>SY0AAD60YD21FM1
TTGGCTTCAAGGGACGTGGTATCACTCGCGCTCAGGCTTTTCAGTCAAAT
TGAAAGCCATATATCTACTAAATTACTTTTGGCCTATCTCATATCGAGGA
CTGGTCGGTACGGTGGTGATATTCCTGTCAGCGGTCACCTGGTCGGATTT
ACTGGACTGCATTGTGCATCGGTTTTCGGCATTGTTGATATCGCAATCGC
TCTCGTGGGCCGGCCAAATTGCGATATCAACAAAAGAGATTTTCTGGGAA
TTACTCCGCTCATATGGGCGACTATATGTGGACAAGAGCGGGTAGTGAAG
CTGCTATTAGAGCATCCGGCTACCATCCCTGACAAGCCGGATAATTGGTT
TCGTCGAACCCCGCTCTCATGGGCTGTCTTCAAGGGGCATGAGGGTATTG
CCAGACTATTTCTTGGCCTGGGGTCTGCCAAACCTGATGTGACAGAAGGC
TGGTGGGGCAAGACTCCTCGAATTGTGAACATGGTCCTCGGGAGAAGATA
TGTCAGCCCCAACAAGCCAGACAAATACGGTCAAACGCCAATCTTGCTGG
CTGCTGAAGAAGGGCATGAAGGGGTGATAAAGGCGCTGCTGGGAAGGAAG
GATGTCAAACCCGACGTGACGGACGGATACGGCCATACCGCTCTTTTTTG
GGCCTGTAG

Sequences in the Contig:

SY0AAD60YD21FM1