Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YD08FM1
Length(NT) : 504
Best Gene Model Blast : Link to GSTUMT00006250001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_10227
Accession: ref|XP_001239205.1| Score: 609 E_value: 7e-62
KEGG Definition: nuclear mRNA splicing factor, putative
Accession: afm:AFUA_6G13410 Score: 582 E_value: 5e-59
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1898 Score: 477 E_value: 5e-49
PFAM Definition: CPSF_A, CPSF A subunit region. This family includes a region that lies towards the C-terminus of the cleavage and polyadenylation specificity factor (CPSF) A (160 kDa) subunit. CPSF is involved in mRNA polyadenylation and binds the AAUAAA conserved sequence in pre-mRNA. CPSF has also been found to be necessary for splicing of single-intron pre-mRNAs. The function of the aligned region is unknown but may be involved in RNA/DNA binding..
Pfam Number: pfam03178 Score: 179 E_value: 2e-14
Swissprot: Q4WLI5|RSE1_ASPFU

Sequence:
>SY0AAD60YD08FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGACAGTTGCTGGTGG
TGACAGATTTGGTAACTTCTGGATCGTCCGCTGTCCACAAAAGGCCTCCG
ACGAATCCGACGAAGACCCCGCCGGTGGACACCTCATTCACGAACGATCA
TACCTCCAGGGCGCCCCCAACCGTCTAAACCTAATGTGCCACTTCTACCC
CCAGGACATCCCAACCAGCGTTCAGAAGGCACAGTTGGTGACCGGCGGCC
GCGACACACTTGTCTGGACTGGCCTCCAGGGAACAATCGGCCTGATGGTC
CCGTTTGTCAGCCGCGAGGATGTGGACTTTTTTCAGACACTGGAACAACA
CATGAGGACCGAAGACGCGCCCATTGCTGGAAGGGATCACTTAATTTATA
GGAGTTACTACGTACCCGTAAAGGGCGTTATTGATGGGGATTTGTGTGAG
AATT

Sequences in the Contig:

SY0AAD60YD08FM1