Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YD06FM1
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00011241001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_08651
Accession: ref|XP_363067.2| Score: 148 E_value: 4e-08
KEGG Definition: hypothetical protein
Accession: ani:AN8767.2 Score: 148 E_value: 2e-08
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 126 E_value: 5e-08
PFAM Definition: No Hit Found
Swissprot: Q14678|KANK1_HUMAN

Sequence:
>SY0AAD60YD06FM1
TTGGGGATTTTACCAAAACAACAACAACGACAACAATGTCATTACTCTCC
CTCCCGAACGAGATAATCCTGCAAATAACTGAAGACTTGTCCCCGGCGCA
ACTCAACTCCCTATTACGGGTAAACCGCCGTCTTTCCAACCTCATCCCGC
ACGTCCTCCTAGAAAGCCTCTTCCGCACACGCTCACCGTGCTTCGGTGCC
CGCGCGCTCTTCAATGCAGCAGAGCGGAATGACTGGCAATTCGTTAAGCG
TCTCGTCGACCGCGGGATCTTCGACTTCGCCGACGACGGATTACTGCTTA
ATCGTGCGGTCGAAGAGACGCGCAGCGAGCGGGTTGTGGCGACGTTGTTG
GCGTACGGTATTAAAGCGGATGCTTGTATGTTTAGAGGGGCACAACTTGG
GGGAACGCCGCTGTGGATCGCGGCAAATTTGGGTTGCCGAGATATCGTCA
GGTTGTTGTTGGGGAGGAAAGACGTTGATCCGAACGGGCGGGCTGGTGGA
GCGCCGTTGATCGCGGCTGTCAAGAGGAATGATGTTTCAATGGCGAGACT
GCTACTATGCAACCCCTTGACGAGGGTCAACCCCGCCGACAAGAACGGGG
AAGTGCCGTTGCAGATTGCGCTGGAGAAGGAGCACCTGGAGATGGTCTTA
CTACTCATGGTGGACGAGCGGATCAACG

Sequences in the Contig:

SY0AAD60YD06FM1