Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YA03FM1
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00006711001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_10526
Accession: ref|XP_366307.1| Score: 198 E_value: 4e-14
KEGG Definition: hypothetical protein
Accession: mgr:MGG_10526 Score: 198 E_value: 2e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD60YA03FM1
TTGGCATTTATGGAATCAGCATTCTTCGGGAATGGAAGCCGAGATGCTGG
AGTTTGTTTTTGAGTCTCAGCGCTTTTTCATTGAATCTTTGAAGCATGAG
CCAGAACCTGAGGCCGGAGGAGCAGATAGGATTCCTGGATATATCTTTAA
ATTACTGGATTGCCTTATGTGCATGTCAAAGCAGGAGACCCCAGAAGGAT
TCTATTCCGCCAGGATATTAGAAACAATGATTTCCACCCTTTCCCAAGAT
GGCAAGATCTCCTCGGCGCAATCTCAGAGCTGGCTAAAGTCAATTGACAT
CAGAAAAGGCCAAGGGATTTATTGCAGCACAGCTATACTAACAGGGCTTA
GCGAGTTGCTGGAGCACACTAAGGAGGCGGAGAAATTAAGAAATGGGTTA
GCGAGTGATATTCCGGGCATACCAGCCTCCGAAGCTAGAGAAGCGGGTCT
ACGAAAAATCGTTTTACTAAACGCAGCGTTACCTAAGCCCGGACAGGACA
CACCAGCATTACCGCAGCAGCGGGCAATATTCCTTATCAAGCATCTTCTT
AGTTGGTTCGAAGATGAGGCGTTC

Sequences in the Contig:

SY0AAD60YA03FM1