Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YP01FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00009307001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05601
Accession: ref|XP_001555926.1| Score: 497 E_value: 1e-48
KEGG Definition: hypothetical protein
Accession: ncr:NCU09469.1 Score: 495 E_value: 1e-48
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0998 Score: 283 E_value: 2e-26
PFAM Definition: No Hit Found
Swissprot: Q9HGL2|YHLA_SCHPO
Gene Ontology:
GO:0005938 = Cellular component: cell cortex
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>SY0AAD5YP01FM1
TTGGATAGGTCCTGCAGAGTTCGTAGTAGCCATGCACCTTATCACGTGTT
CAAAGAATGGCACTCTCCCTGTATTACCCCAGATTCTACCCCCTGGACTC
TATGAGGCTGCTGCAGGGCGTGGTCCCACAAGGAATGGCGATCGAAGGCC
AGCAGGAAGGGGCATTCCACCCCCACCTATGCCTCCCGTTCCTCCAATTC
CCCAACAGTATAGTGGACCTTTGCAACAAGGTCGCGCGCAATCGCCCCGG
ACATTCACCCCCCCTGTGACACAACCTGGCCAACTGGAAGCTGCTGGGGA
ATGGGTCATCACGCCTGCCGATAAGGAGCGATTTGACTCGGTCTTCTTGA
CAGTCGATAAGCAGAACAAGGGATACATTACTGGTGAGGAGGCGGTGCCG
TTTTTCTCAAACTCTAGGCTTCCGGAGGATGTTCTTGCCGGCATTTGGGA
TCTTGCTGATACTAATGGGTCCGGGCGCTTGAGTCGCGAGGAGTTTGCCA
TCGCTATGCATCTAATTCGGGAGCAGCGCAACTTTCCCGATGGCAGCGGT
CCTCTGCCAGAGGTCCTTCCTCCGAATCTAATTCCTCCTAGCATGCGTGC
GCCAGGGCAGTTC

Sequences in the Contig:

SY0AAD5YP01FM1