Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YO01FM1
Length(NT) : 540
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_04040
Accession: ref|XP_001594233.1| Score: 298 E_value: 1e-25
KEGG Definition: hypothetical protein [EC:2.3.1.97]; K00671 glycylpeptide N-tetradecanoyltransferase
Accession: mgr:MGG_07229 Score: 250 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q4I061|NMT_GIBZE

Sequence:
>SY0AAD5YO01FM1
TTGGAGCAAACCATGTCCTCTGAATCCAAACCAGAAGACACCTCGGTGCA
TGGGGAAGTCGCGCCAGAAGCTACTGCAGACTCAACGACCACTAAAACAG
CAGAAGTCGAGTCGGATCACGAAGATGAAGAAGAAACTGCCCCCGCCGTC
GACAGCAGTGCTCCAGCAGCAAAGAAGAAGAAGTCAAAGAAGAAGCGCAT
AAAGGCTGCACTTGGAGGTGGAAGTGGGGAATCAGAAGCAGGTCCTTCGA
GGGAGAGCATCGACAAATCGGTCAGCAGCATGAGCAACAACGACATTCAG
GAATTGCTGAAGATGAACCCCGCGTTGGCAGATCAGCTGGGTGTTGGAGC
TGGCACGTCGCCGAGTGATGCCGCGAATGCGTTGAGGAAATTGAAGCTGG
AGGATATCATGACGGGGTTGGCGGCGAGTGGGAAGAACGTGAAGGATATG
GGCTCATACAAGTTTTGGGGAACGCAACCTGTGCCGAAGTTTGGGGAGAC
CGGGGAGATTAAGGAGGGTCCCTTCAAGATCATTGATCTG

Sequences in the Contig:

SY0AAD5YO01FM1