Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YN18FM1
Length(NT) : 243
Best Gene Model Blast : Link to GSTUMT00007952001 E-value : 4e-67
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_06425
Accession: ref|XP_369910.1| Score: 203 E_value: 7e-15
KEGG Definition: hypothetical protein [EC:4.1.1.48 4.1.3.27 5.3.1.24]; K01609 indole-3-glycerol phosphate synthase; K01658 anthranilate synthase component II; K01817 phosphoribosylanthranilate isomerase
Accession: mgr:MGG_06425 Score: 203 E_value: 3e-15
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0026 Score: 151 E_value: 1e-11
PFAM Definition: No Hit Found
Swissprot: P00908|TRPG_NEUCR

Sequence:
>SY0AAD5YN18FM1
TTGGAAAATGTCTAATCCGGGTTCCGCTCAGCCGGCATTGTCGACCGCAT
CGAATGTCATAATGATTGGTAAATGTTCCAAGTAAAGGAATCGTAGTTAT
CAATCATTATGACATTCGATTCCTTTACTTGGAACATTTACCAATTTCTC
ACACTGGAAGGAGCTAAGGTTACCGTTTACAGAAACGATAAAATCACTTT
ACCTGAATTGATCGCTCTGAGTCCAACCCAGATTGTTATTAGC

Sequences in the Contig:

SY0AAD5YN18FM1