Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YN15FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00008708001 E-value : 1e-124
Numbers of ESTs : 1

Blast Results:

Nr Definition: thioredoxin reductase
Accession: ref|XP_001560033.1| Score: 330 E_value: 3e-29
KEGG Definition: CaO19.4290; putative thioredoxin reductase [EC:1.8.1.9]; K00384 thioredoxin reductase (NADPH)
Accession: cal:CaO19_4290 Score: 324 E_value: 7e-29
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0404 Score: 339 E_value: 8e-33
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 109 E_value: 3e-06
Swissprot: Q7Z7S3|TRXB_PNECA

Sequence:
>SY0AAD5YN15FM1
TTGGCCAGCCCATGACCTTCCATCACTCAGCATTTTTCCTCGCTTCTTCC
TGAATTTGTTCTCTCTTCTTCTCCAGAGACTTTGGCCCTTATAATATAAG
GGTTGGTCCGGTCCCTGACTACTTTCTAACCTTTCCCCTTCCATATTTCT
TCTGTCGACCTTTAATCCATCAAAGTCATCCTCCTGCAACCCTTTCACCA
CGTTTTCCTCCCGCTTCACCAGATTTCGCTCATTGCCCTCGCTTGGCATC
CCTCTCTTCGCTGCTGCTTCAATCAACAAAAAACATCAAGCTTCAAAAAC
AGTCCTTCAAACAAGCCGTGCCATGCACAGCAAAGTATTATTGGGTATGA
ATTGGCCGATTACCCCGCCATCATGAGATTAACCCCCCACTAATTTCATT
ACCCATCGATTCAGGTCCGGCCCAGCCGCCCATACCGCTGCGGTATATCT
GGCTCGTGCAGAATTGAAACCTATTATGTATGAGGGGATGCTTGCAAATG
GAATTGCACCCGGTGGACAGTTGACGACAACTACTGACGTCGAAAATTAT
CCGGGCTTTCCTAAAGGCATTGGTGGCCAAGCGCTTATGGAGGCTATGAG
AGAACAAAGTGAACGATTCGGAACCACAATAATCACGG

Sequences in the Contig:

SY0AAD5YN15FM1