Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YN10FM1
Length(NT) : 508
Best Gene Model Blast : Link to GSTUMT00010372001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55995.1| Score: 490 E_value: 4e-48
KEGG Definition: sideroflexin
Accession: aor:AO090005001008 Score: 490 E_value: 2e-48
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3767 Score: 415 E_value: 7e-42
PFAM Definition: Mtc, Tricarboxylate carrier..
Pfam Number: pfam03820 Score: 414 E_value: 1e-41
Swissprot: Q12029|FSF1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAD5YN10FM1
TTGGCCCTCCTCCCACTATCTCCTCACTCCTCTGCCGTCTCCCCCTTCTT
TTTACAAGGGAGAACATAACATACTCTTCAGAAATAGTATCTGTCATGTC
GTCCTCAATTCTTGGTACTCGCGAATTGCCTTTGTCCCAGTACGATCTTT
CAACGTACTGGGGCAGAGTCAGGCACTCTGCAGATATCGCAGATCCTCGC
ACCCTGTTTACCTCCCAAAAATCCCTCGATGCTCACACGGCCCTCCTGGC
GAAATACAAGCGCGGTGAGATCCCCCCACAAATGACCCCCGAACTCTGGC
ACGCAAAGAAAGTGGTCGACGCAACCTTGCACCCAGACACCGGAGCGCCC
GTCTTCCTTCCCTTCCGCATGTCCTGCTTCGTCTTCTCGAATCTGGTCGT
CACAGCGGGGATGCTCGCGCCAAACCTGACCACCCGCGGAGTCCTAGGCT
GGCAGATCGCCAACCAGACCCTCAACGTTCTCATCAACACCTCCAACGCG
AACAAATC

Sequences in the Contig:

SY0AAD5YN10FM1