Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YN02FM1
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00006663001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial carnitine:acyl carnitine carrier, putative
Accession: ref|XP_001258540.1| Score: 552 E_value: 3e-55
KEGG Definition: mitochondrial carnitine:acyl carnitine carrier, putative; K03454 mitochondrial carrier protein, MC family
Accession: afm:AFUA_6G14100 Score: 549 E_value: 4e-55
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0758 Score: 417 E_value: 5e-42
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 245 E_value: 5e-22
Swissprot: Q12289|CRC1_YEAST
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0005476 = Molecular function: carnitine:acyl carnitine antiporter activity
GO:0006631 = Biological process: fatty acid metabolic process

Sequence:
>SY0AAD5YN02FM1
TTGGCAGGGGTTGTATGCGGGTGTATCGGCACCATTGATCGGTGTTACAC
CGATGTTTGCTGTATCATTCTGGGTCCGTCACCAATCACCCTCCTGCTCA
ATCCAAACCTAACAGATACCAAAGGGTTACGACGTCGGTAAAAATCTCGT
CCGCCGCTTCGCAACAGTCAACAGCAACCAAATGTCTATCGCGCAAATTT
CCTTTGCAGGCTTTTTCTCGGCGATCCCGATGACTCTTATCACCGCGCCC
TTTGAGCGGGTAAAGGTTCTCCTGCAAATACAAGGCCAGACCGGGGAAAA
GAAATATTCCGGTGGTATGGATGTTGTCCGACAGCTTTACAAGGAGGGCG
GCATTCGCTCAGTATTTCGTGGATCGGCAGCGACGCTGGCCCGAGATGGA
CCCGGATCCGCAGCATACTTTGCCACATACGAGTATATCAAGCGACGCCT
AACACCCGAGGGTGAGGGTAAGTTGAGCATGAGCGCTGTGATGGTTGCGG
GGGGCGCCGCAGGTATGGCGATGTGGTTGTTGGTGTTTCCCGTGGAT

Sequences in the Contig:

SY0AAD5YN02FM1