Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YJ23FM1
Length(NT) : 488
Best Gene Model Blast : Link to GSTUMT00011708001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06444
Accession: ref|XP_001592205.1| Score: 192 E_value: 1e-13
KEGG Definition: hypothetical protein; K03217 preprotein translocase YidC subunit
Accession: ani:AN8229.2 Score: 168 E_value: 4e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD5YJ23FM1
GGAATTATACCATTATACCATACACGCTACCATCTATGCAAAGAGAGAGA
CAATGCTGGCCTCGAAATTAATATTGAGGTCTTCCTCCTCAGCCGCCTCA
ATTTCTCTCCGCCGAATTTCACAACCTGCATCTTCGAGAAAGATCTCCTC
CTTCGTATTCCCAAGAGCCTCCCGTCTCCCACAACCTCTCCTCTCGAAGA
CTTTCCCGAAACTCGCCCCGCTCACGGCTCTTCGCTTCAGCTCAACCTCC
GGCACGACTCCACCACTCTCTGAACCCACCTTCCTCCCAGATTACACACC
AACAACCCAGTCCGTTTCGGCCCCTATCCCAACCTCCGAGCATATCGGGT
TCCTCAAAGAATTCGGCTTAGACTATGGCTACGGATTCACAACCCTCGTC
CAATCCCTTATTGAGCATGTCCACGTCTATGCCGGCACGCCCTGGTTCGC
TACGATAATCCTCAGCGTAGGTGTACTTCGTTTGCTAC

Sequences in the Contig:

SY0AAD5YJ23FM1