Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YH23FM1
Length(NT) : 534
Best Gene Model Blast : Link to GSTUMT00004303001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01856.1
Accession: ref|XP_382032.1| Score: 432 E_value: 3e-41
KEGG Definition: hypothetical protein
Accession: fgr:FG01856.1 Score: 432 E_value: 1e-41
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2798 Score: 402 E_value: 3e-40
PFAM Definition: N2227, N2227-like protein. This family features sequences that are similar to a region of hypothetical yeast gene product N2227. This is thought to be expressed during meiosis and may be involved in the defence response to stressful conditions..
Pfam Number: pfam07942 Score: 471 E_value: 2e-48
Swissprot: Q80UY1|CI041_MOUSE

Sequence:
>SY0AAD5YH23FM1
TTGGCCTTCTCTAGCTTAAACCCGCACATCTGGACTAGTGCAAGGACTTC
ATCGAGGCACAGCTCGAACTTTCCCGCAGCTCCCACGTCCTCATCTTCCC
CGCTATCCCTCCTCTTCCGTTGTTGCTGCTCCTGGGCATGCTCTTCAAAG
TGCCAGAGCAGCGGTCCAAAGTTCACCCAGATCCCGTCGTCGACAAGCAA
GTGCTTGATGGTCTCAAGGTAGGAGATTAAGTTCGGTGCTGTGTCGATGA
AGAATACGGTGGCGCAGACGTCAAATTTTTGCGAGGGGGGGAGGTCTTTG
TAGGATTGGCGGAAGTCGCCCGCTGTCATGCTGAATCTGTCGGTACCCGT
GAGCTCGAGAAGGGTTTCGGGATGGACGTCTGGGATTTGGATGCCGCGGA
GGTGGTCGGGGCGGGTGGAATGATTGCTGAAGATTGAGATGAAGGGGTGG
AGGGTGTGTTGATATGCGGTGGTGGTGTGATTTAGGATGTAGTTGCTGGC
CATCAGTTGGTGGTAGGAGAATTCATTTCCTTGG

Sequences in the Contig:

SY0AAD5YH23FM1