Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YG19FM1
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00008663001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10502
Accession: ref|XP_001588954.1| Score: 294 E_value: 3e-25
KEGG Definition: hypothetical protein
Accession: mgr:MGG_11784 Score: 258 E_value: 2e-21
KOG Definition: No Hit Found
PFAM Definition: Miro, Miro-like protein. Mitochondrial Rho proteins (Miro-1 and Miro-2), are atypical Rho GTPases. They have a unique domain organisation, with tandem GTP-binding domains and two EF hand domains (pfam00036), that may bind calcium. They are also larger than classical small GTPases. It has been proposed that they are involved in mitochondrial homeostasis and apoptosis..
Pfam Number: pfam08477 Score: 125 E_value: 4e-08

Sequence:
>SY0AAD5YG19FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAAGTCACGGAATTGGCTC
CTTTGATAGCTATTCAAGCAGCCACCTATCGGGTCAGTCGCCGACATTAG
GGCCTCAGCATGGTGAGCAGACGATTCTAAGGGATTTTGAAAATATGTCA
CCGAACAATTCCATTCGCGATCTCTGCATTGCTGTGGTAGGGGCAAGGGG
TGTGGGCAAGAGTACTTTTATTCAGAGGGCGTATGATCTGAAATCTCTGC
CGAATGAAGATGCTGTTACTGCAAAGCTTATGACAGTTGAACGGTCACTA
TGTACTGTCAAACTGGTGGAGGTAAATCTGGCAAAACTTGATCTCGACTC
TCAACAGTTGGTTTGGCCGCGGGCGATGGACGGCCAGAGGCTCCCGTTCG
TCGACGGGGTGCTTATCCTATACGACGTGACAAACCCGGCGAGCATTGCC
AATTTGCCTGAATCTCTCGATGCTTTCGCGAGGGCTGCGCTCCCGACACT
GGTGGTCTCGTGCAAATGCGACGCACCGCAGCGACAGTTAAATCCTAACA

Sequences in the Contig:

SY0AAD5YG19FM1