Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YF08FM1
Length(NT) : 517
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 306 E_value: 1e-26
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 303 E_value: 1e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 241 E_value: 1e-21
PFAM Definition: No Hit Found
Swissprot: Q71S21|INVSB_XENLA

Sequence:
>SY0AAD5YF08FM1
TTGGGCAGGGTCCATATTTTCACATTAATGGTTGCGATAGACTTTCCAGT
TCAATGGTTTACACTGTGCATGCATGTTCGGGATCGTTGAGATTGTAGCT
GAATTGCTCGAGGTAGAAGGCTGCGATATCAACCAACGAGACTGCACGGG
CAATACACCACTCGCGTGGGCTGCTTGGAATGGGTACGGAGGAGTGGTGG
GAATACTACCCGGGCGGAACGACGTCGACCCCAATAAATTAGATAAGGAT
GGCGATACACCGCTTCATTGTGCTGCCTTTAATGGGCACGAAGGGGTGGT
GAAAATACTTCTCGAACGGAACGACGTCAGCCCCGATAGACCGGATAATA
ACAGCCGAACACCACTCTGGTGGGCTGCTCAGAATGGGCACGAGGGAGTG
GTGAAGATACTACTCGGACGGGACGACGTCAATCCAGGCAGACCGGACTG
GCATGGCCGAACATCACTCTGGTGGGCTGCTGAGAATGACCGTGCCGGGG
TGGTGGCGCTGCTGGTG

Sequences in the Contig:

SY0AAD5YF08FM1