Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YE24FM1
Length(NT) : 370
Best Gene Model Blast : Link to GSTUMT00002345001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_10409
Accession: ref|XP_001228336.1| Score: 324 E_value: 6e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU06774.1 Score: 310 E_value: 1e-27
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4469 Score: 184 E_value: 2e-15
PFAM Definition: Rgp1, Rgp1. Rgp1 forms heterodimer with Ric1 (pfam07064) which associates with Golgi membranes and functions as a guanyl-nucleotide exchange factor..
Pfam Number: pfam08737 Score: 375 E_value: 2e-37
Swissprot: Q8BHT7|RGP1_MOUSE

Sequence:
>SY0AAD5YE24FM1
TTGGCAATAAGGCTGATGGGGGATTTCTCAGTGGGTTTGGATGGGGGGGG
ATTGGCGGGGGTATTACAGGGCTTTTGGGAGGGAACAATATGAGTTCTAT
TGCAGAGATGAAGAACATCGCGAATTCGAGATCAATACCCATACTCTCGA
CCCCACAATCGATTCTCTTCGTCGATTTACGGCTGAACCCGGGGGAGAGC
AAGTCTTATACTTATAGCTTTCCTTTACCTAAAGGCCTCCCTCCTACGCA
TCGGGGGAAGGCTATCAAGGTTGTTTATAACTTGGTTATCGGGACACAAA
GACCTGGGAAAGGGGTTCAACAACCCAAAGTTGTTGAGATCCCTTTTAGG
GTCTTTCCCCATGTTCATGC

Sequences in the Contig:

SY0AAD5YE24FM1