Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YE14FM1
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00002341001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06761
Accession: ref|XP_001797124.1| Score: 186 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: ani:AN1164.2 Score: 176 E_value: 8e-12
KOG Definition: No Hit Found
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 114 E_value: 8e-07
Swissprot: Q1MTS0|YBH9_SCHPO

Sequence:
>SY0AAD5YE14FM1
TTGGGGGAGGATGGGAAGGAGAAGGATGGCAAGCTGGTGAACACAATGGG
AGGGAAGGGAGAGCCGGAGAGGAAGAAGGTTAAGATTTGTACTACCGCAG
CGTCGAAGGCGCCCTCAAAGAAGTCAATACCAGGACCCACAAAACCCGAG
TCAGACTTCGACTCGGATATTGAAATCGACTTTTCCAAACCAACACCCAC
CGCCCGCCCACCTCCTACAACCTCCACCTTCGCTTCAACATCGCATTTCG
GCGACCCCACCTACCTTTCACACCCCGATGCCCTCTCAAAATCTGCTAAA
AAGCGTACCCTCCGCTTCTACACTTCGCAAATTGTGTCGAAATCCGCCAC
GCGCGCGTCCGCCGCCCAGTCACACTCGGGTGACATGGACCTCCCGCACA
AGGAGCGTTCGAAGGAGCGCGCGATCCGCTTACAAGCCGAGGCTGCGCGG
AAGCGTAGCGCGGCGGACCCGACCGCTGACCTGGGTTACTCCAGCGGCGG
CGAAGGCGCTGGCCCTGTCCCTAGGCGGGGGAAGAATGAGAGGGAGGAGG
AAGAGGAGGAAGAGGAGGACGAGTAC

Sequences in the Contig:

SY0AAD5YE14FM1