Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YC13FM1
Length(NT) : 482
Best Gene Model Blast : Link to GSTUMT00010303001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13922
Accession: ref|XP_001804123.1| Score: 339 E_value: 1e-30
KEGG Definition: hypothetical protein [EC:6.3.5.1]; K01950 NAD+ synthase (glutamine-hydrolysing)
Accession: mgr:MGG_04178 Score: 223 E_value: 2e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD5YC13FM1
TTGGGAAAACCCACTTTGCACAATGCGGCGCAAAAATCAAGGAACTAGCG
AAGAACGGTTCCCTTCCATCCGAGTATATCTACACTGGTCCTGTGAAAGG
TCCCCTGGGCCAGGCACGAAATAGCAAAAATCCAGCATTCCTGGTAACGT
TTGCCGCCTGCGAGGAGTACTGCGGTGTAACACCAGAATACTACGAGTGG
GAAAAAGCCTCGGATACAATCACGACATGGGTGCTCCCTTTGGTGGGTCT
GATTCTGCAGGCCCCCTTCGAGAGCAATAACTTCAAACAAACCATGTTTG
TTGTATTCAGGTGGGTGGGCTCACCTATCGTTTCCATGATGTGTATTTTC
TGGAACATGAAGGTTACCAGGAAGTGCGCTATTATGGTTGACATGAGCGT
CGACAAAGACCAGTACCCCCCACCACCAAGCAGTTTCGCGGAGTTGAGAG
ACTCTTTTTACCTCCTCAGCGTGGTTAACCAA

Sequences in the Contig:

SY0AAD5YC13FM1