Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YB15FM1
Length(NT) : 549
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: 60S ribosomal protein L14
Accession: ref|XP_001551610.1| Score: 461 E_value: 1e-44
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g391 Score: 419 E_value: 5e-40
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3421 Score: 406 E_value: 9e-41
PFAM Definition: Ribosomal_L14e, Ribosomal protein L14. This family includes the eukaryotic ribosomal protein L14..
Pfam Number: pfam01929 Score: 243 E_value: 9e-22
Swissprot: P38754|RL14B_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0003723 = Molecular function: RNA binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006412 = Biological process: translation

Sequence:
>SY0AAD5YB15FM1
TCGACAAATACGCCCAAACATTCACAATGGGTGACGCAGAGATCAAGGCA
TCGTCATGGAGACTCGTGGAGGTTGGCCGCATCGTTCTCATCCAGGACGG
TCCTTCAGCCGGAAACCTCGCTGCAGTTATTGAGATTATCGATCACAAGA
GAATTCTCGTCGATGGTCCATCCACAGACTCCAAGATCGCTACCCCCCGC
CAATCGATCCCCCTCGCTCACGTCGTCCTTACTCCAATCGTTCTCGAAAA
GCTACCCCGTGGAGCCCGAACTGGTGTCGTCAAGAAGGTCTGGGAGAAAG
CCGGAATTGAGGCAAAGTGGCAAGAAAGCAGCTGGGCAAAGAAGCGTGAA
CAGAAGGAGCGCAGACGGGCTTTGACCGATTTCGAGAGATTCAAGGTTAT
GCGTCTGAGGAAGTCAACTCGTTTCGGTGTTCGTGTAGCTGCTGCTAAGG
CTAAGGTTGCGGCGAAGTAGATGATTTGGGCTTGAGGGATTGGAATGGTT
TGGGTTTGCGAGCATGACTGCACAGGGTTGCTGGATTCCTTTGCTCCTC

Sequences in the Contig:

SY0AAD5YB15FM1