Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD5YA16FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00012075001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64642.1| Score: 773 E_value: 1e-80
KEGG Definition: serine/threonine protein kinase [EC:2.7.11.1]; K08832 serine/threonine kinase 23
Accession: aor:AO090011000088 Score: 773 E_value: 6e-81
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1290 Score: 633 E_value: 7e-67
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 134 E_value: 5e-09
Swissprot: P36616|DSK1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0007243 = Biological process: protein kinase cascade
GO:0007346 = Biological process: regulation of mitotic cell cycle
GO:0048024 = Biological process: regulation of nuclear mRNA splicing, via spliceosome

Sequence:
>SY0AAD5YA16FM1
TTGGATCACTTCACCAATGATATTCAGACTAGGCAATATAGATCCCCGGA
AGTCATCCTTGGCGCTAAATGGGGAGCTAGCACGGATATTTGGAGCATGG
CTTGCATGGTTTTTGAACTCATCACTGGCGACTACTTGTTCGACCCTCAA
TCAGGCACCAAGTACGGCAAGGACGACGACCATATTGCCCAGATCATCGA
GCTTCTCGGCAGCTTTCCCCGTCACCTCTGCATGACGGGCAAGTGGTCTA
TGGAAATCTTCAACCGCAAAGGCGAACTCCGAAACATCCACCGCCTCCGC
CACTGGGCTCTCCCCGACGTCCTCCGAGAAAAATACCACTTTTCGCGTGA
GGACTCTGAACAGATCTCCGAGCTCCTGGTGCCAATGCTAGAACTGAACC
CGGAGAAGCGTGCGAATGCCGGTGGGATGAGCAATCATGGCTTCATTAAG
GAGGCCATAAGCATGGAGAATAAAAACGTAGATGTCGTCGTCGGAAGTAG
AGGTGGAATCGAAGGTTGGGCGTGCGAGGTTAAGAAGAGATAGACAAAGA
CTGAAGGGAGTCTTTCTTTAATCCTTTCCTGTTTTTCCGGTTGCTTTCTG
AAATTTCCTAGCTTTATTATCTCTTTCTATTAACTG

Sequences in the Contig:

SY0AAD5YA16FM1