Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YO21FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00002337001 E-value : 1e-118
Numbers of ESTs : 1

Blast Results:

Nr Definition: RL2A_ERYGR 60S ribosomal protein L27a (L29)
Accession: ref|XP_388032.1| Score: 235 E_value: 3e-32
KEGG Definition: RL2A_ERYGR 60S ribosomal protein L27a (L29)
Accession: fgr:FG07856.1 Score: 235 E_value: 1e-32
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1742 Score: 246 E_value: 3e-22
PFAM Definition: L15, Ribosomal protein L15..
Pfam Number: pfam00256 Score: 123 E_value: 5e-08
Swissprot: P02406|RL28_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005634 = Cellular component: nucleus
GO:0003723 = Molecular function: RNA binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006412 = Biological process: translation

Sequence:
>SY0AAD59YO21FM1
TTGGGTACCATCCAGGATACTTCGGAAAAGTCGGTATGAGGTACTTCCGT
AAGCAGCGCAATCATTTCTGGAACCCCGTTATCAACCTTGATAAAGTGTT
TTTCTTTTCTTTTCTTTTTTTTTCTTAAAAAAGCTGTGGTCCCTCGTCCC
TGCCGAATCCCGTAGCAAATACCTCTCGGCGAAGTCTGACACCGCTCCCG
TCATTGACTTGCTCGCGCTGGGATACTCTAAGGTCCTTGGTAAGGGTCGT
CTCCCGGAGGTCCCCGTCATCGTCAAGGCGAGGTATGTCTCTGCGCTTGC
GGAGAAGAAGATCAAGGAGGCTGGTGGGGTTGTTGAGCTTGTTGGATAAA
AAAGCAAAAAAATTCAATATCAACTTCATTTCTTTGCCTTTTCCCCTTTC
TTCTATTATTTCCCGGGATTATGTTTTTTTTTTTTTTGCGCTTGTATGGA
GCAACATCTCTTTTTTTTCTCGACCGATAAATGTCAAAAAATGGTTTCTG
GGTCTTTATGTTTGGTTGGGC

Sequences in the Contig:

SY0AAD59YO21FM1