Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YO14FM1
Length(NT) : 440
Best Gene Model Blast : Link to GSTUMT00003754001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: branched-chain amino acid transaminase
Accession: ref|XP_001546913.1| Score: 473 E_value: 3e-46
KEGG Definition: branched chain aminotransferase BCAT1, pyridoxal phosphate enzymes type IV superfamily [EC:2.6.1.42]; K00826 branched-chain amino acid aminotransferase
Accession: aor:AO090023000977 Score: 452 E_value: 4e-44
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0975 Score: 337 E_value: 6e-33
PFAM Definition: Aminotran_4, Aminotransferase class IV. The D-amino acid transferases (D-AAT) are required by bacteria to catalyse the synthesis of D-glutamic acid and D-alanine, which are essential constituents of bacterial cell wall and are the building block for other D-amino acids. Despite the difference in the structure of the substrates, D-AATs and L-ATTs have strong similarity..
Pfam Number: pfam01063 Score: 288 E_value: 3e-27
Swissprot: P38891|BCA1_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004084 = Molecular function: branched-chain-amino-acid transaminase activity
GO:0009082 = Biological process: branched chain family amino acid biosynthetic process
GO:0009083 = Biological process: branched chain family amino acid catabolic process

Sequence:
>SY0AAD59YO14FM1
TGTACAAAAAGTTGGCCTTGTATCGTCCCCCAACTTGACGCTGCAAGGTG
CATAGTTTCCGCCGAGCTTCATGTCTCCGACACCGCCGGGCCAGGCACCT
TGTATCGTCCCCCAACTTGACGCTGCGTCTCGTGGCTTCCATCAAAACCT
CTGGCTCTTTGGCGAGGAAGGATATGTTACTGAGGTGGGAACAATGAACC
TCTTCGTCGCATGGATCACCCCTGAAGGCCAGAAGGAAATCGTTACTGCT
CCGTTGGACGGAACTATTCTCGAAGGTGTCACCAGAGACTGCATCCTTGC
ACTCGCGAGGGAACACCTCACTAAGGAGGGCTGGGAGGTTAGCGAGCGTA
AATTCACCATCGGGGAGGTAGCTAAAGCTGCAGATGAAGGCAGGTTGGTC
GAGGCCTTCGGGAGTGGGACCGCCGCAGTTGTATCACCGA

Sequences in the Contig:

SY0AAD59YO14FM1