Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YO07FM1
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00008038001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12002
Accession: ref|XP_001586973.1| Score: 208 E_value: 1e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG06075.1 Score: 198 E_value: 6e-18
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2066 Score: 139 E_value: 1e-09
PFAM Definition: No Hit Found

Sequence:
>SY0AAD59YO07FM1
TTGGGGAGGACATCTGAACAACCTTATGTCTGCCGCCACTGATGGTTGAA
TCAGAGTCATAGGCTGGGTCCGAAGCATCAGCATCAACCACAATCCGCTC
AATCTCATCGTACTCGCTTAAAGAGGCAGTATCGGACGAAATAATGTCGG
GCTGCGCATCGACTAATTCCCACGCATCCTTGTACTTTTCCTTCTCCAAC
AGCCATCCAAGATGATCTTTTGGGCTTCTCTCAGTAGCAAACACTACATC
ATAGGGACTAGTAATATAGATTTTTTTGCCCGGGTATTCCTCCCACCCGA
CATCTTCCTTTTTCTCCTTCATTCCCCGGAGACCAGAAAGACTTCCCGAG
GCCTTACTCGCACTCGCATTGCTGAAACTTTCTCGTCGAGACACGCTGCC
CAGACTTCGCACACTCGCTGCGCTAGAAAATATCTGTGTAGCATTCATTC
CCGCAGCCCACAAATAATTGCTTGCGGTACCTATACCGAGAATATCACCT
TCTCCAGAAGCTGAAGGAGGGCGAGTGGTCATAGGTGGGTTAGTCGGTAA
ACACCAAGGTGGTAATCACCAACAGCCAGGCCCTCGAATCTGCTCATCAA
TAATTCGTCCGCGCTTACTTCTTCTGACGTGT

Sequences in the Contig:

SY0AAD59YO07FM1