Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YN24FM1
Length(NT) : 439
Best Gene Model Blast : Link to GSTUMT00009777001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_07734
Accession: ref|XP_001240571.1| Score: 542 E_value: 3e-54
KEGG Definition: hypothetical protein
Accession: ani:AN9077.2 Score: 542 E_value: 2e-54
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0391 Score: 554 E_value: 5e-58
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 151 E_value: 2e-11
Swissprot: Q5ARK3|SWR1_EMENI

Sequence:
>SY0AAD59YN24FM1
TTGGATTTAATAACGATACAAGGATTCTCGTCTTTATCCTATCCACCCGT
TCCGGTGGGCTTGGTATCAACTTAACAGGTGCAGATACTGTGATATTCTA
TGATTTAGACTGGAATCCCGCGATGGACAAGCAATGCCAAGACCGATGTC
ATCGTATTGGTCAAACTCGTGACGTCCACATCTACCGCTTCGTCTCTGAA
TACACCATCGAGTCAAATATTCTCCGGAAGTCAAACCAAAAGCGAATGTT
AGATGATGTGGTCATTCAAGAGGGCGATTTCACAACCGACTACTTCAACA
AACTCACAATCCGCGATATGCTCGGAGATGAAGTTATCAAGGATCTAGAT
GGCGTGGACGATTCGCAAACAGTGGTTGCCCCCGGGGTCAACATGGAGAA
AGCGCTCGAGGCAGCCGAAGATGTTGAGGACGTTGCAGC

Sequences in the Contig:

SY0AAD59YN24FM1