Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YN20FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00004642001 E-value : 1e-113
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001239054.1| Score: 262 E_value: 1e-42
KEGG Definition: hypothetical protein
Accession: ncr:NCU02480.1 Score: 268 E_value: 1e-42
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 121 E_value: 1e-07
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 123 E_value: 8e-08

Sequence:
>SY0AAD59YN20FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAACTTTTTTGTACAAAGT
TGTCCCCGGCTCTGTCATTCTTGCTGATCTTAATGATGTGGGACTTCAGG
CAGCTAAGAGAAAGGTTGAGGCATTAATTCCAGGCGCTAAGTTCAAGATA
TTCAAATGTGATGTTAGCAACGAGGAAAACGTGAAAGCACTGGTTGCAGA
AGCCGATGAATGGGGTGGTGTTGATGTGATATTTAACAACGCTGGTATCA
TGCACAATGATGTCCGTCAAATACACCTAGGATTGGGGAAGGGAAAAAGT
CCATCAGGACCACGACTGACCCCGTTATAGGACGGTGATGCTATCTCCAC
CAGCGAGGATGTTTGGGACCTCACCCATAAAATCAATGTTTGTTACGCTC
CTGTCTAATTCAAAGAATTGAGACTCAAGGATACCTTAGGTCAAAGGTGT
TTGGTACGGTTGCAAACATGCCGTCTTGTCGTTCCGCAAGCACAAGAAGA
CCAAGGGGTCTATCATTAACACCGCATCCGTCGTGGCCCTAGTTGGGAGT
GCCACGGCCCAAGTTGCATATACTGCCTCTAAAGGTGCAGTTTTGGCGCT
TACTCGTGAATTA

Sequences in the Contig:

SY0AAD59YN20FM1