Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YK06FM1
Length(NT) : 459
Best Gene Model Blast : Link to GSTUMT00011856001 E-value : 1e-116
Numbers of ESTs : 1

Blast Results:

Nr Definition: phosphoglycerate mutase family protein
Accession: ref|XP_001265750.1| Score: 352 E_value: 4e-32
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G01840 Score: 342 E_value: 2e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4754 Score: 139 E_value: 7e-10
PFAM Definition: PGAM, Phosphoglycerate mutase family. Y019_MYCTU and YK23_YEAST are not included in the Prosite entry. However these sequences are significantly similar and contain identical active site residues..
Pfam Number: pfam00300 Score: 115 E_value: 4e-07
Swissprot: P36069|YKM8_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD59YK06FM1
TTGGGATTTGGAGGAGACGGATCCAGGGAGATTTGATTGGATTGAGAGTG
GGTTTGGGTTGTTGGATGAATTTGGTGTTCCCGGGCTTGAGATGGAAAGG
GAGGGGGAGGGGGAAGGAGAGAGGAGTAGGAAGTGGGGAAAGTTTCGGAA
GGCTATTGGCAGGTTGAACAGCCAGGCGCCAGGGAATACGGTTTATAAAG
TGCTGTATTTGGCTAGGCATGGGCAGGGTTTTCATAATGTTGCCCAGGAG
TTCTACGGTACCCATCTTTGGGATTGTCATTGGTCCTTGCTGGATGGGAA
TGGGACTTCCGTTTGGGCCGATGCTGAGCTCACGAATATTGGTATCACGG
AAGCTCAGCGAGCGAATATTGCTTGGAAGGACCAGATTAAAGCCGACGTC
CCGTTGCCGGAGAGCTACTATTCTTCTCCATTGAGGCGTGCTGCAAGCAC
CCTCGAGAT

Sequences in the Contig:

SY0AAD59YK06FM1