Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YH04FM1
Length(NT) : 487
Best Gene Model Blast : Link to GSTUMT00006526001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_03344
Accession: ref|XP_001229860.1| Score: 450 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06462 Score: 412 E_value: 2e-39
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2002 Score: 275 E_value: 1e-25
PFAM Definition: No Hit Found
Swissprot: O42668|TPR1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0030007 = Biological process: cellular potassium ion homeostasis
GO:0009992 = Biological process: cellular water homeostasis
GO:0006813 = Biological process: potassium ion transport

Sequence:
>SY0AAD59YH04FM1
TTGGCGTTGGTACAGTAGATAAAAACACCCATATGGACAATGCGGCAAAA
ATATTTGATGATGCCGTTCGAACTTCACGGGCGACCAATATGCTTGCGAT
TATGGGAAGAGCGAGAGTTTTGTATGGAAAAGGGAGATATGAGAGAGCAC
TCGAATCGTATCAGGAGGTATTGACCAAGAGGCCGGATATGGATCCTGAT
CCGAGGATAGGAATCGGATTGTGCTGTTGGCACTTGGGGCACAAGGACGA
CGCCTTGGTGGCATGGGAGCGTGCGCTGGAGTTGGACCCCAATTCCAAAT
ATGCTCATATACTAAAGGCGTTATACCATCTTCATGTCACCTCAAATTTG
TCAGAATACGACCCTGAATTCATCAACAATTACCGTTTGGTGATTGAGCA
TACCCAGAAGGCATTTAAACTCGACAAGCAATTCCCACTAGCGTGCACAA
CATTTGCCAGCCATTTCTTTATCAAGAAAGGATATTC

Sequences in the Contig:

SY0AAD59YH04FM1