Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YG22FM1
Length(NT) : 510
Best Gene Model Blast : Link to GSTUMT00008655001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_07057
Accession: ref|XP_001797412.1| Score: 224 E_value: 5e-18
KEGG Definition: hypothetical protein
Accession: ang:An02g01970 Score: 219 E_value: 6e-17
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1612 Score: 124 E_value: 5e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAD59YG22FM1
TTGGCTAAATACCTCCTCCGCGACTTCGCAACTTTCCTTGATGACCCGCT
TAACAACTGCCCTCCCAACACCTCCACTCCCCCCTTCCAGAGTCCTCACG
CCAACGACCTTCTTTCCACAAATCGAGACGGCGAGAACCACATCCCCGGC
GGATAATTCTTCCCTTGTGGGGTCGAAGAATATGTTCTCGCCAACGTTGA
CCACCAGCAGGGTTATCGGCGGGGGGATTTTGCCAACGGGGTACAAAGGC
AGAGCATTATCCCAGTCGTCGTCAAAGACTGGGTCCTCCACGACTTCAGA
GATCAATTTCGGCAGGAAGGTGTTACGGAGAGCAAGGTATGTCGTGAGCG
TGAGCAGAGTAGCGGGATGTGATAGCGGGGGCGCCAATAGCAATATCTAT
TCATCCAGGCCTTCTTATCAGCGCATCGTATCACAATAGCGAGCCAGACG
GTAGCTGGAAGAAGGAAGGGAAACAAACATCGACAAAAACCTTCCAATGA
AACCTCTCAC

Sequences in the Contig:

SY0AAD59YG22FM1