Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YG11FM1
Length(NT) : 544
Best Gene Model Blast : Link to GSTUMT00011326001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CAGL0M09779g
Accession: ref|XP_449771.1| Score: 319 E_value: 3e-28
KEGG Definition: hypothetical protein [EC:3.2.1.14]; K01183 chitinase
Accession: cgr:CAGL0M09779g Score: 319 E_value: 2e-28
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4701 Score: 401 E_value: 4e-40
PFAM Definition: Glyco_hydro_18, Glycosyl hydrolases family 18..
Pfam Number: pfam00704 Score: 131 E_value: 8e-09
Swissprot: P29029|CHIT_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005576 = Cellular component: extracellular region
GO:0009277 = Cellular component: fungal-type cell wall
GO:0005635 = Cellular component: nuclear envelope
GO:0008843 = Molecular function: endochitinase activity
GO:0006032 = Biological process: chitin catabolic process
GO:0007109 = Biological process: cytokinesis, completion of separation

Sequence:
>SY0AAD59YG11FM1
TTGGAATTGATGGGACGGACTTGCATCGCTGTCCCGAGTTTGGCACCGCG
ATCAAAGATTGCCAGGCACGGGGGAAATTGGTGCTCATGAGCTTGCAGGG
AGCTTCGGGGATGCAGACGTTGGCTGATGATGCCGCGGCGTGTGAGTACG
CGGATAATCTTTGGAGGCTCTTTGGGGAAGGCACAGGACTAGAGTCCATG
AGACCGTTTGGCGATGCTAGGGTCGACGGCTTTGATATTGACAACGAAAA
CAACAACTCGAACGGCTGGCCGAAGTTCATCTCCGAGCTCCGCAACAAGT
TCGCCTCCGCTTCCAAAAAGTACTACATCTCCGCCGCGCCCCAGTGTGTG
CGCCCCGACAAGTCGATCGGTAGCGCGATCTACCTCGTCGACTACCTCTT
CATCCAGTTCTATAACAACTACTGCGCGACCACCGGCCTCGTATCCTGCT
TCAACAACTGGTCCGAGGATATCGCTGCCAACGGCATCGCTGGAGCGAAG
GTATTCGCCGGCTTCCTCGGTGCCCCAGATAAGGGACAGGGCTA

Sequences in the Contig:

SY0AAD59YG11FM1