Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YF23FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00009161001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: Amidohydrolase 2
Accession: ref|YP_373709.1| Score: 154 E_value: 5e-09
KEGG Definition: amidohydrolase 2 [EC:4.1.1.45]; K03392 aminocarboxymuconate-semialdehyde decarboxylase
Accession: bur:Bcep18194_B2954 Score: 154 E_value: 3e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD59YF23FM1
TTGGGATACACATCACCACTACTTCGGGGACTCGGTCCCAGAACTGGTAT
CAGAATTCACAAACGATGGAGCTCAAGCCTTCTTCTTCCCAAAGGGCGTG
GACGACCACTTGAAGTACATGGATTCCATGGGAATCCAGACGGCCGTACT
GGCGCCAAGTATCAAGATGGAATGGCATACCCAATGGCCACCGGCGAGAT
GGAAGAACCTGTGCGAGAGGACGCTGAAAGCCCAGCTGAAGGTTCAGGAA
TCGAATCCGCTCCGCTTTGGTATGCTTTTATCTTTCCAATTCTTTGCGCA
AAAGTGTGGCGCGGGCTTATCAAAAGCACGAAGGGACGTTTGCCATGCTC
CCCTTCCCGCATGTTAACGAGACTTTGGACTTCGTGAGGGATATATACAC
CCGTGAGGTCAAGCCAGATGGTTTCGCGCTGTCTACGGCTATGGGGAATA
AATACCTCGGTGATCCAGCCTTCGATCCCATGTGGGACGAATTGAATATG
CATAGCGCAGCGATTTTCGTCCACCCTGCGGACACTGCAATGCCGCCGGG
ACTGGAGTA

Sequences in the Contig:

SY0AAD59YF23FM1