Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YF18FM1
Length(NT) : 421
Best Gene Model Blast : Link to GSTUMT00001471001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213764.1| Score: 491 E_value: 3e-48
KEGG Definition: predicted membrane proteins, contain hemolysin III domain; K07036
Accession: aor:AO090003000602 Score: 482 E_value: 1e-47
KOG Definition:
Classification: [General function prediction only, Signal transduction mechanisms].
Kog Number: KOG0748 Score: 398 E_value: 5e-40
PFAM Definition: HlyIII, Haemolysin-III related. Members of this family are integral membrane proteins. This family includes a protein with hemolytic activity from Bacillus cereus. It is not clear if all the members of this family are hemolysins. It has been proposed that YOL002c encodes a Saccharomyces cerevisiae protein that plays a key role in metabolic pathways that regulate lipid and phosphate metabolism..
Pfam Number: pfam03006 Score: 227 E_value: 3e-20
Swissprot: Q09749|ADRL_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAD59YF18FM1
TTGGAGCGGTCGCAAGGGTGGGCAACAAACTCGACTACCTGGGCATAATA
ATCCTAATAATGGGATCCTTCATCCCGAGCGTGCACTACGCCTTCTACTG
TCGCCGGCGCCTCGCATACGCCTACTGGAGCATGATCTCCCTCCTGGGCG
CCGGGTGCGCCGCCGTTTCCGTCATGCCGGGCTTCCGCACGCCGGCGTGG
AGGCCCTTCCGCGCCGGCCTGTTCGTCTCGATGGGCCTCTCCAGCGTGCT
GCCCGTCCTCCACGGCGTGCGGATATATGGCACTCGTGGGATGGACGAGA
GGATGGGGGTGAGGTGGTTGCTCATCGAGGGGTTACTATATATCGCCGGC
GCCGGGATCTATGCTGCTAGGGTTCCCGAGAGGTTCGCGCCTGGGAGGTT
CGATTTGCTCGGGGCTTCGCA

Sequences in the Contig:

SY0AAD59YF18FM1