Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YE02FM1
Length(NT) : 654
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11024
Accession: ref|XP_001587784.1| Score: 369 E_value: 8e-53
KEGG Definition: hypothetical protein
Accession: fgr:FG10945.1 Score: 223 E_value: 7e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD59YE02FM1
TTGGCAACTATCTAGATTTCGACGATGTCTTTGTCTTCGATAAAGAGTAC
AGCTATCATCAAGATTCCGTCCACGCAATCGAGGCGAATAGGAGGGAACT
CGAGGGTCTGTTCATTGACAAGGTGTTAAAGATTCTTGGAATCAAACGCC
CTTTGAAACACTATCCTCCGAGAACTAATAGCGGTCTGAGAGACCTTCAC
AAACTCATTAGCGACGGTCCTGCCGTGGACCATCACAAGATTTCCATTCT
CTACTATCTTCTCTTGGACATCGACTGCCCGACTGGCAGGAGGGACTTTT
CAACGGCGTTCGAGGAGAAGGCTTTCTTGCCCCAAAAATATGTAATATAC
ATGAAGGGATTGTGGCATTTGGATAATCAGGAATACGAGGTTCATGACCT
ATTTCCAGAACCCATATCGCACAATGTTAACAGCTCTACAGGAAGCACTA
CAATACCTCACCCATCCTTCTCTCGTTCCAGATTTTGCCGATGAAGTCCT
CGAAGTTCTGGTTCGAAAAAATAAAGACCCCGCTCTCGCACTTGCATACT
ACTACAGTGTCCAACCAACCCTCAAAACTGCAGCATCTATCGAATGTCTT
TTCACCTCGATAGCCAAAACCAGCGTCACCGAAGCATTCTTCTTCGCTAG
AGGA

Sequences in the Contig:

SY0AAD59YE02FM1