Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YC24FM1
Length(NT) : 558
Best Gene Model Blast : Link to GSTUMT00000874001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_02502
Accession: ref|XP_001596282.1| Score: 318 E_value: 3e-30
KEGG Definition: hypothetical protein [EC:3.2.1.101]; K08257 mannan endo-1,6-alpha-mannosidase
Accession: spo:SPCC970.02 Score: 326 E_value: 3e-29
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_76, Glycosyl hydrolase family 76. Family of alpha-1,6-mannanases..
Pfam Number: pfam03663 Score: 359 E_value: 3e-35
Swissprot: O74556|YCZ2_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0051692 = Biological process: cellular oligosaccharide catabolic process

Sequence:
>SY0AAD59YC24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCATTTCCAATGGTCTTTTC
TTCCACATGGGCGCCCGGTTGGCAAGATATACTGGGAATGGCATTTTTGT
AATCATATCCCTTGTTGGTTGACACAACCTGCCATTTCCAATGGTCTTTT
CTTCCACATGGGCGCCCGGTTGGCAAGATATACTGGGAATCAGTCTTATG
CAGATTGGGCTGAGAAGGCTTATGATTGGTCCAGGGAAATTGGTTTGGTC
AGCCCGGAATACAAGGTCTTCGATGGTGCTCATATCCCGGAATGTAACAT
TTCCAGTGTCTATCAGTGGACTTATAATGCTGGTGTCTATCTCTCCGGTG
CTGCTTACATGTATAACTTTACCAATGGAACCAATCAAAAATGGAAAAAC
GAAATAGAGAAGCTCATGAATGCTACTGCAGAGCCCTTCTTCTCAACAGA
GCCACCGAATATTATGCAGGAGTCTACTTGTGAAATTCGGATTTACCGGA
ACCGATCCCACCTGTAACACTGACCAACGTTCTTTCAAGGCTTATTTTGC
TCGTTTCC

Sequences in the Contig:

SY0AAD59YC24FM1