Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD59YB06FM1
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00002373001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An08g00550
Accession: ref|XP_001392173.1| Score: 560 E_value: 7e-56
KEGG Definition: hypothetical protein
Accession: ang:An08g00550 Score: 560 E_value: 4e-56
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3590 Score: 107 E_value: 7e-06
PFAM Definition: PXA, PXA domain. This domain is associated with PX domains pfam00787..
Pfam Number: pfam02194 Score: 117 E_value: 5e-07
Swissprot: Q9USN1|SNX12_SCHPO

Sequence:
>SY0AAD59YB06FM1
TTGGACCCGTGCTATTGCCTGAGAGGGAAAGGAAGAGTAGGGCCGTTGCG
ACAATTGTGAAGGAGATTGTGGCTTGTGGCATTTTGTTCCCGGTTATGGG
GATACTGAGCGATCCAGATACTTGGAATCAATTTATTGAAGCTATAGGTC
GGTCAACTCTCCAAGATCGTAAAACTGTTCGAAAGCTCAGAGCTGCCCTG
GATCAACATGCTACTCCACGGCACCCAAACTCCCTCGGCCACTCGAGGAA
TTACTCTCAGGTGGAACTTGCGCCAAGTCAACCATTCATACGGCTTTCTG
CCAAAGACGACGAACGCACTTTCGAGCGCTTTATTCGGTCTATCAGGCTT
TGTAACAACCTCTCCGACGCTAGAAGATTGAGGAATGAGGTCAGTGCTCA
ATTGAAGAGAGACGAAAGGGTTGAACCAAAGGAAGGATGGGCTGTCTACC
TACGTAGGCTAGAGACCGGCAAGCGAGAGGTTGATAAGAGGGTTGCTCAA
TTATCGGCCAGTGTTGCGGGACCAGGCGGTGGACCTATAAGGACACATTC
GGAGGTGCTCGTTCCCAAACAGGCTACAACTAGTCACTTGGAGTTTGCCA
CTCCGCAACAGGTTCTTCGAGATTCATCTGGGCTGTCTTACTTCATGGAG
CATATGGACCGGCGTAGACGCTTGCCCTTAGTGCAGTTCTGGCTTG

Sequences in the Contig:

SY0AAD59YB06FM1