Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YN04FM1
Length(NT) : 452
Best Gene Model Blast : Link to GSTUMT00008212001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_14261
Accession: ref|XP_001584806.1| Score: 310 E_value: 3e-27
KEGG Definition: AGL186Cp
Accession: ago:AGOS_AGL186C Score: 305 E_value: 5e-27
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3191 Score: 328 E_value: 7e-32
PFAM Definition: MTS, Methyltransferase small domain. This domain is found in ribosomal RNA small subunit methyltransferase C as well as other methyltransferases..
Pfam Number: pfam05175 Score: 104 E_value: 6e-06
Swissprot: Q03920|MTQ2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding
GO:0008276 = Molecular function: protein methyltransferase activity
GO:0008757 = Molecular function: S-adenosylmethionine-dependent methyltransferase activity
GO:0018364 = Biological process: peptidyl-glutamine methylation

Sequence:
>SY0AAD58YN04FM1
CTATGAGCCAAGCGAGGATACATTCCTCCTTCTCGATACTTTAGCTCTCC
AATCTCCCTTTCTGCGCTCCCGATTCCCACAAACTTCGCTCCCGCTAGCC
CTTGAGCTCGGTAGCGGTTCCGGCGTAATAACGTCCTTCCTCACCACACA
CTCAGCCACACTCTTCGGTCACACCTCAATCACAACTTTATCCACTGACA
TCTCTCCGCATGCTCCAGACGCTACAAAGCAAACTGTTTCCGCCAATATA
ACCGAAGAAAGCGGATGCTTTCTCGGGGCTATTAGGACGGATTTAGCGAC
AGGTCTAAGACCGGGAGTGGTAGATATGCTAGTGTTTAACCCGCCCTACG
TGCCCACGGAGGTGGTGGAAGATGGGAACGGAGAAGAGGGGTGGATTGGC
GTTGCGTGTGGTGGGGGGGTTGATGGGATGGAGGTTACAATTCGGGTATT
GA

Sequences in the Contig:

SY0AAD58YN04FM1