Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YG05FM1
Length(NT) : 528
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_07642
Accession: ref|XP_001553229.1| Score: 228 E_value: 1e-17
KEGG Definition: predicted protein
Accession: aor:AO090026000320 Score: 213 E_value: 3e-16
KOG Definition: No Hit Found
PFAM Definition: HET, Heterokaryon incompatibility protein (HET). This family represents a conserved region approximately 150 residues long within various heterokaryon incompatibility proteins that seem to be restricted to ascomycete fungi. Genetic differences in specific het genes prevent a viable heterokaryotic fungal cell from being formed by the fusion of filaments from two different wild-type strains. Many family members also contain the pfam00400 repeat and the pfam05729 domain..
Pfam Number: pfam06985 Score: 176 E_value: 4e-14
Swissprot: Q9UV10|HET6_NEUCR

Sequence:
>SY0AAD58YG05FM1
TTGGCAGCAAAGCTTGTTACATTGGAGTACAATAAAGACCAACTGCCGTC
GGAAGAAGAAGATATATGCTCAACAAGGATACGTCAGGACGTCCCTGGTT
TCGATTTCGACGTAGCCGAGAATCCACTAAACGATGGAGATGCGTTGATG
TACATACCTTTACTCCCGGGTGAGATCCGGCTTTTCAGACTCGAGCCCCG
GGATATCTCTCGTACTCGGGACTCCAGTCAGTTCCTTGTTCGAGGCGTAT
TGGAGTGCCACCGCCTCGCGGATCACCCTCGATACAACGCGCTTTCCTAT
TGCTGGGGCAGTGATGCTAATCCGAGACCTATATCTGTCAACGGAGAAAT
CATTTTCGTCCACAGCAATCTCGAAGCAGCGTTTCGAGAACTCCAAAGTT
ATCGAGGGGATATGCTCCTATGGGCAGATCGACTATGCATCAACCAAAAA
GATGATGATGAGAAAACTGTGCAGGTGCAACAGATGAGGCACATATACAG
TGAGGCCTCCCTAGTTTTTGCTTGGCTT

Sequences in the Contig:

SY0AAD58YG05FM1