Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YF20FM1
Length(NT) : 655
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05663
Accession: ref|XP_001592742.1| Score: 269 E_value: 4e-22
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03622 Score: 190 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YF20FM1
TTGGAAGGCGATTCTCCTCATCGAAACCTTCCAATTCTGCAGCTTCGAAG
CCATCCAATCCTGCGAATGGTCCAAAGGGAGTGGCTGGGGCTGTAGCAGC
TGCCCCAGAAAGGCAGTCCGCAGAGAACAAAGCAGAATTACCAGATGCCA
ATGAGGCAGAAAAGAAGGCATCTTCCCAGGAAGCACCTCCTGTAGAAAAG
AAAGCTCGGAGTAGCAAGAGGAAATCGAAGGAAGATAGCGCTATAGTCAA
AGGTAGACATGAATCGTTCTTGCATCTGCCAAGTGTACCCAGCACACAAC
ATATCCCTCCAAACTTGATTGCCGCTGCCGATTTCTTCTCCCTCTACCGA
CCACTTAATCTCCTGAATCCCTTCCCGAAACCAGTCACCGATGAAGAGTT
TGCAGCAATTTTCACTAGAACTAGAGGGAACGCAAAACCTTCCCAGGTGA
TCTCTACTCTTTCAAACGCAGTTGATGCATTAAATCCTACCTCGGGAAAG
CAAAGAAAGGCTTCAAAAGCCCAGCAGGCACAATGGAATGAGGAATCAGA
TGACTTGGGGCATTCTGTGACCGCAGAACTGTACGGCCAAGAGGACGTAC
AACATCTTGATGGGGCTGGGCAGGAGCCACTTATGGATTTCCCCAAGCAT
GTCTT

Sequences in the Contig:

SY0AAD58YF20FM1