Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YE10FM1
Length(NT) : 568
Best Gene Model Blast : Link to GSTUMT00003829001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU06216
Accession: ref|XP_962932.1| Score: 166 E_value: 2e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU06216.1 Score: 166 E_value: 1e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YE10FM1
TTGGAAACAAACGAAAACCGTCTTGCACCTCATACCCCTCCAACCTTGAA
ATCCACTTAGAGTAAGTCGCCTTAATTATTATTTCAATGCCTGCTCGAGT
AGCTGGCTCACGATCTGCTCGTACGCGAGCCCCACGAAAACGAGCCCCCG
CCGCCGCCGAGGAAACTCCAGCTACCACATCTCCAGCACTTGAACCTAGC
CCACCACCAGCAACTTATACTCCGCTTCAAGATGCCATTGCAACTATATT
TCAATCGGCCCAGAAGACTACAGCTGGTCACAGGAAATTGGCAATTACGA
TGCGGTCTATTTGGGAACAGTGTGCAGCAGGCACTGGGTCCCTGGGCACG
TCCATCGGTGGGGGAAGGGTTGGAGAAAAGGCCTTTGTCAAAGGATTCAC
TAGTTTCCTTAATAGGGTTCTTGTGACCAAGAAAAGTGAGGTTGTGGGAG
ATAGATGCTTGAGATTCATAGACTTATTCGTGAGGGGGCTGCTTGATAAA
GATAAACCTAAGAAGAAAGACGGTGAAGATGAGCAAATGATAGAAGGTGA
AGAAGGGGCTGTTGAAGA

Sequences in the Contig:

SY0AAD58YE10FM1