Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YE05FM1
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00005573001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: AGAP006770-PA
Accession: ref|XP_308975.4| Score: 261 E_value: 3e-21
KEGG Definition: AgaP_ENSANGG00000017717; ENSANGP00000020206
Accession: aga:AgaP_17717 Score: 261 E_value: 1e-21
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0958 Score: 282 E_value: 3e-26
PFAM Definition: JmjC, JmjC domain. The JmjC domain belongs to the Cupin superfamily. JmjC-domain proteins may be protein hydroxylases that catalyse a novel histone modification..
Pfam Number: pfam02373 Score: 230 E_value: 3e-20
Swissprot: Q9V6L0|JHD3B_DROME
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0051864 = Molecular function: histone demethylase activity (H3-K36 specific)
GO:0016564 = Molecular function: transcription repressor activity
GO:0016577 = Biological process: histone demethylation

Sequence:
>SY0AAD58YE05FM1
TTGGGGTCGTCAGTGGAAAAACATCCTCACTGGAATACCGCGGGACGGCC
CAACCCAATACTCCTCAGACAATGACATAACGGACGACTTACGCAGATAC
CTCTCCCTCTCCGATCCGAAGCTAACATTGCTCCCGGGTAACGTCCTCCA
CGACAACATAACCGCCGTGACAGGGATCCAAACACCATACCTATACATCG
GCCAGGCGTACACCATGTTTGCTCTACATACGGAAGACTACAACGCACTA
TCCCTGAACTACCAACACTCCGGCGCGCCCAAATCATGGCGCGTCTGCTC
GCCACGGAGCTTCACCGCCCTGGAAGACTTTATCGCAGCGAGCATCCCCA
ATGCCGGGAATTGCTCGCAGTTTGTCAGGCATCAGAGTATCTATCTACCC
CGGGAGACGCTTGAGGGAGCGGGTGTGAGGAGTATACTTGTTCGACAGTT
TCCGGGAGAATTGGTGATTACTTGGCCGCTGGCCTACCATCAGGGGTGGA
ACGAGGGGGTTAATGTTAACGAAGCGTGTGGATATGGGAACGAGAGGTGG
AGAGAGTTGTTCCCCGAAAAAGCGAGGAGAGTAAAAGAGGGTAGGGGTGT
CGGTGGGGGAAGTGTTTATAGGGCTTGTGGTGGGAGGTGTGT

Sequences in the Contig:

SY0AAD58YE05FM1