Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YE03FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00009118001 E-value : 1e-121
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN2779.2
Accession: ref|XP_660383.1| Score: 200 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: ani:AN2779.2 Score: 200 E_value: 1e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YE03FM1
TTGGCGCCCCTCGTTCCACCGCACACACGCACTTCACTCCGCATAATGCG
CTCTGTATGTGTTTTTATGCTTTTGTATTCCCGAATACTTTGCCCCGCTC
CTTGTATGGTAATTTTTTTCCCTTTGAATGGTGGGGAGAGGGGAGATGGG
GTTAGGTAAGGCGATGAAAGGGGAAATTGCTAGGGCCTTGTGAGGCTGCG
TGATAGAATGAGGCATTCGGTATCAGGTAGTCTATAATATTATGGAGTGG
ATAGGAGTTACCTCCCCCCGGAGATTATTTTGTTGATCACAAGTTATCTT
GAGGACTACTATTCAATCATCTTACCTGCCATGACCGAGAACGCAAGTGC
AAGCGCAACCGCCAATGCCACCACCGTCAACGGGATGTCGGGGAATCCTC
TGCAACCGAAGAACTACGAAATTGCCGGAACTCATCCAGATAGCAGAATT
CTGTTTCGTGATGTTCGTATTCTGGATTCCACTGGGAGAGAGCCTTATCC
TGGTGATGTTCTGATTAAAGGAGAACGTATCGTAGAGGTCGGTACAGTT

Sequences in the Contig:

SY0AAD58YE03FM1