Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YD16FM1
Length(NT) : 547
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_01249
Accession: ref|XP_001560417.1| Score: 182 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG00849.1 Score: 166 E_value: 1e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YD16FM1
TTGGGTCATCCATCAAAGGCGTTCATTTGCTTCATCTTCGTCAATCATCG
TCATTCCTTGATATTGATTGTTTCGACACTCGTTCTCCGTCAAATACCAA
ATCCTCAGCCTCATTTCGCTTTTTCAGCTGAACATAAACAACAACCGCAA
CAATGGGAGCAGGAAGATTCGTTTGCGTGGCTCTGCCACTCGGCCTGACA
ATTGCCAGCATTGTCGCCCTCTTAATCGCCATGCTCGGCGGCGTCACTGA
CAAAAATCTCGGACTCTTCGAAATCAAGACTCAAGACCTCTCCATCTCCT
CCTCATCGCTCGAGAACCTCGTCGATACCATCACTCGTCGACAGCTCGAC
ATCGATCTCGACAACTTTGATCTCAGCAGTCTCAATATCGGCGACCTTGA
TCTCGACAACCTCAGCGTTTCTGAAATTGCTGCCAAGCTCAAGGAAGAAG
GAGTTGAGGGCGCTGATGATATCGCACAAAAAGTCAAGGATGCTGGAAAA
GATGGTATCAACAATCTCCTGAACAATGCAAAGGATGATGCGAAAGA

Sequences in the Contig:

SY0AAD58YD16FM1