Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YD04FM1
Length(NT) : 459
Best Gene Model Blast : Link to GSTUMT00000281001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: gb|EDS26872.1| Score: 161 E_value: 5e-10
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03371 Score: 152 E_value: 3e-09
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4501 Score: 126 E_value: 2e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YD04FM1
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAGGAGGT
CAGGAGCTTTGGACCGGTAAGGAAGAAGGATAAGGGGAAGGGGAGGGAGG
TGCTGGATTTAGAGGGTTTAAGTAGAGAGGAGGAGAGCAGCCTTACGACA
AAGGTTGAGAGTGTTCGCGATATATTACCCCACCTTGGGACAGGCTTCGT
GAGGAGGTGTTTGCTACAGATGGATGGGGACGTGGAGAGGGTTACCGCAG
CAGTGCTAGAAGGGAATTTGCCTGGTGATTTGAATTTGGCGGATCAGGGG
GAGGAATTCATCCCACCAGAAGCCCCGGAGCCACCATCGGCATACGCTAC
TCCCCCTTCCGAACCAGCAGATTCAGAATTCCCCGCTCTCCCGGTCCGCC
GCAACATATTCGACAACGACGAATTAGACCTCCTAACCCCCTCTGCAACC
ACCCGTCTC

Sequences in the Contig:

SY0AAD58YD04FM1