Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YC18FM1
Length(NT) : 304
Best Gene Model Blast : Link to GSTUMT00003041001 E-value : 1e-160
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06757
Accession: ref|XP_001592516.1| Score: 397 E_value: 2e-37
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05699 Score: 376 E_value: 3e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2006 Score: 220 E_value: 1e-19
PFAM Definition: No Hit Found
Swissprot: Q9V3C5|RIC1_DROME

Sequence:
>SY0AAD58YC18FM1
CATTGCTCGTCCAGTTTTGCAGACGAATGAGAAAATACTCATATACCGCG
GCTATGATAAATCCGATATTGCAGCAATTTCACAGGAGACTAGTGTGCTA
TGGCATCATGTGCAAATGCCTTCGGTGTACTTGGTTGACAATTGGCCAAT
CCGAAGTGCGGTTATATCACCGGATGGAAGATATGTTGCAATAGCTGGCA
GGAGGGGGCTTGCCCATTATTCAGTCAATAGCGGGCGCTGGAAAACATTT
ATCAATGAGAATATGGAACAGGATTTTGTGGTACGGGGGGGCATGTGCTG
GTAT

Sequences in the Contig:

SY0AAD58YC18FM1