Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD58YC09FM1
Length(NT) : 576
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU07285
Accession: ref|XP_962139.1| Score: 384 E_value: 1e-35
KEGG Definition: hypothetical protein
Accession: ncr:NCU07285.1 Score: 384 E_value: 6e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD58YC09FM1
CAAGTCAACTAAGTACCTCACAGCCACAGAGCGACAGATCAATATGTCAC
CCAAATCTAGCGAAGTGCCTTACAGGCAGATCAGAGCAGTTTATGACCAA
GATACCATTACCGTCTATCAAGCCTACTCGGAAGCCATCGCCACCGCAGC
GGTCCGCGAGCAGAAATTATGCGCAAGCCGAGAGTATAGCTTTGAGAGGT
ATACTTGGATTAAGCCTAGTTGGTGCTGGATGATGTATCGCTCAGGATAT
GCACTTAAAGACAGCAGACAAACTCGAATCTTAGCACTTAAGATCTCGCA
TGAGTCGCTGAAGACACTGTTGATGAGTTCTGCGGTTTGCAGAGGCAAAA
CCCCGTTTACGAACGAGGAGAAAAAGGCTCCTGTAAGGGTGCAATGGGAT
CCGGAGCGCAGCCCTAAGTTGGGTGTGTTACCGTACAGAAGTATTCAGAT
TGGAATTGGGAGGAGTATGAATAAGCAGTTTGCGGAGGAGATGGTGGTGG
GCATTGAAGATGTGACTGATCGAGCGGCGAAGCTGCGAGAAGTTTTGGGA
AAGAATCCTGTTGAAGGAGAAGAGAA

Sequences in the Contig:

SY0AAD58YC09FM1