Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YP11FM1
Length(NT) : 344
Best Gene Model Blast : Link to GSTUMT00008492001 E-value : 1e-102
Numbers of ESTs : 1

Blast Results:

Nr Definition: cytochrome c heme lyase
Accession: ref|XP_001211930.1| Score: 272 E_value: 9e-29
KEGG Definition: holocytochrome c synthase/heme-lyase [EC:4.4.1.17]; K01764 cytochrome c heme-lyase
Accession: aor:AO090206000030 Score: 272 E_value: 3e-28
KOG Definition:
Classification: [Energy production and conversion, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3996 Score: 196 E_value: 8e-17
PFAM Definition: Cyto_heme_lyase, Cytochrome c/c1 heme lyase..
Pfam Number: pfam01265 Score: 233 E_value: 4e-21
Swissprot: P14187|CCHL_NEUCR
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>SY0AAD57YP11FM1
TTGGGTTTCAGGGGAAGAGTCGGGAGATGACGCCTAAGGCCAGGATGTTC
CAGGTGCTTGGGAGGGTTTACCCGGAAAAGTTTGGGTAGGTGATTAGTTT
GATTGATCGGTTGGTTGAGATGTGTGGAGACCGAGTTAATGATTGTGCGT
GTATTTCAGGGGACCTCCGCCGTTCGATAGGCATGATTGGTACGTACTTC
GACAGGGCGGGAGAGAAGTTCGCTACGTTATCGATTATTACTCTGCGCCA
CCGGAGCCTACAGGTGAGCCGGTTTTCTACCTGGATGTTAGACCCGCCAT
TGATAGGCCGAGTGCTATCCTCGAGAGAGCTATGGTGTGGGGAG

Sequences in the Contig:

SY0AAD57YP11FM1